Query (optional)   in Class  

GrainGenes Probe Report: BG274853-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG274853-7B
Data at Wheat_SNP
BG274853-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;T>C at 34;35
Reference sequence GCTCCTTGCATAGTGTTTGTTGATGAAATTCCTTTTGTTGGGAGGCAAAGAGGAACAGGTATCGGTGGTGGGAACGATGAAAGGGAGCAGACTCTCAATCAGCTACTGACTGAGATGGATGGTTTTGAGGGCAACACTGGCATCATTGTTGTTGCTGCCACCAACAGGGCTGACATCTTGGATTCCGCTTTGCTTAGACCTGGACGCTTTGACAGACAGGTTAGTTTCTATCCAGGTTTTTTTAAGGTTAATAACATCAGTCTGGAATTTTTGCATGTCCCTATTTCCATATTCTTATCATTGCAATTATTCCTGCAACAGATTTTAGAAAAAAAAATCTTAGTGAGGTTCTCACGTGCTTGTAAACCTCAAGTCCAATTCTAGTTCAGAGCTTGAACTATCTTTGAATATCTAAAACTTGGAACCTGTTAGAACCTATTTTTCAATATTCTGGATCTTGCTTAACATTTGGATATACCTTGTAACTTGTTTCACAGGTGAGTGTTGATGTTCCTGATGTACGTGGAAGAACAGAGATTCTCAAAGTGCAGGGTAGCAACAC
Type
EST
SNP
Sequence
NSFT03P2_Contig18207
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01