Query (optional)   in Class  

GrainGenes Probe Report: BG274853-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG274853-7D
Data at Wheat_SNP
BG274853-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;DEL;DEL;INS;C>T;C>A;A>T at 226;389;412;617,6;624;710;732
SNP DEL;DEL;INS at 112;134;340,3
SNP DEL;DEL;INS;G>A at 112;134;340,6;469
Reference sequence CTCCTTGCATAGTGTTTGTTGATGAAATTGATGCTGTTGGGAGGCAAAGAGGAACAGGTATCGGTGGTGGGAACGATGAAAGGGAGCAGACTCTCAATCAGCTACTGACTGAGATGGATGGTTTTGAGGGAAACACTGGCATCATTGTTGTTGCTGCCACCAACAGGGCTGACATTTTGGATTCCGCTTTACTTAGACCTGGACGCTTTGACAGACAGGTTAGTTCCTATCCAGCTTTTTTAAGGTTAATAACATCAGTCTGGAATTTAATTTGCATGGTCTAAACCCTATTTGCATATTCTTATCATTGCAAATCTTCCTGCAAAAGTGTTTACCTTACTTTGTTCTTTCTTACTAAGATCCTCAGGTTCTTTCTATCCGGCTTTTTTAAAGGTTAATAACATCAGTCTGGAATTTAATTTGCATGTCCCTATTTCCATAAGGTTAATAACATCAGTCTGGAATTTAATTTGCATGTCCCTATTTCCATATTCAGGGGTGCATGGAAGCTTTGCTATCCATGTGCCAGAGCCATGAGTTGGTCGCGAGATCTTATGGATTTCACCTCTAGCCTACCCCAACTTGTTTGGGATTAAAGGCTTTGTTGTTGTTGTTGTCCCTATCTCCATATTCTTATCATTGCAGTTATTCCTGCAACAGATTTTAGAAAAAAAATCTTAGTGAGGTTCTCATGTGCTTGTAAACCTCTCGTCCAATTCTAGTTCAGAGCTAGAACTAT
Reference sequence GGTCTAAACCCTATTTGCATATTCTTATCATTGCAAATCTTCCTGCAAAAGTGTTTACCTTACTTTGTTCTTTCTTACTAAGATCCTCAGGTTCTTTCTATCCAGCTTTTTTAAAGGTTAATAACATCAGTCTGGAATTTAATTTGCATGTCCCTATTTCCATAAGGTTAATAACATCAGTCTGGAATTTAATTTGCATGTCCCTATTTCCATATTCAGGGGTGCATGGAAGCTTTGCTATCCATGTGCCAGAGCCATGAGTTGGTCGCGAGATCTTATGGATTTCACCTCTAGCCTACCCCAACTTGTTTGGGATTAAAGGCTTTGTTGTTGTTGTTGTCCCTATTTCCATATTCTTATCATTGCAGTTATTCCTGCAACAGATTTTAGAAAAAAAATCTTAGTGAGGTTCTCATGTGCTTGTAAACCTCTAGTCCAATTCTAGTTCAGAGCTTGAACTATCTTTGAGTATCTTAAAACTTGGAACCTGTTAGAACCTATTTTTAAATATTCTGGATCTTGCTTAACATTTGGATATACCTTGTAACTTGTTTCACAGGTGAGTGTTGATGTTCCTGATGTACGTGGAAGGACAGAGATTCTCA
Type
EST
SNP
PCR primers
BG274853_cpR1 GTTGCTACCGTGCACTTTGA
BG274853D_F3 CTGGAATTTAATTTGCATGGTC
Sequence
NSFT03P2_Contig18207
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01