Query (optional)   in Class  

GrainGenes Probe Report: BG274948-5,7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG274948-5,7D
Data at Wheat_SNP
BG274948-5,7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;G>C;G>C;T>A;T>C;G>C;G>A;T>A;C>T;DEL;G>A;G>T;C>G;G>A;A>G;DEL at 29;43;44;49;86;160;481;490;501;512-515;548;651;657;695;697;728
Reference sequence CTTTGACCGACGAGCAGTGGCTGAAGGTTGAATGTGCGCTCAGGGATCTCATTCTTTCTGATTATGCGAAGAAAAACAACGTTAATACTTCTGCACTTACGCAATCTGAGATTCGTGATATAATACTTGGTGCTGAAATAGCTCCACCATCACAGCAGAGGCAACAGATTGCTGAGATTGAGAAACAGGTAAACTTTCTATACCACCCTTTGTGTCTAGTTTCTATGCATAGTAATTGCGTCAGTTTTCCTCATTCTTGGATTTGCTTGAATTTGCAGTCCCGAGAGACAAATCAGGTAACTGCACAGACAACAAGGACAGTTAATGTGCATGGAGATGAGCTCATCGTCACAACAACCAGTCCGTATGAGCAAGCAGCGTTTGCATCGAAGACAGATTGGCGTGTCAGGGCCATCTCTGCTACGAACCTGTATCTCCGTGTCAACCACATTTATGTTAACTCGGATGATATAAAGGTCAGTACTGCAATTTCTTTTCTTCGATTTACCCATAAAACCACCAAATAACAATTGTCCAATGGTTACTTGCTGCTTGTATTATGTGTACAGGAGACTGGCTATACTTACATCATGCCAAAGAATATATTGAAGAAGTTCATATGCATAGCAGATCTGCGGACACAGGTTGCAGGTTTCCTGTATGGGCTGAGTCCACAGGATAATCCCCAAGTCAAGGAGATCAGATGCATATCCATTCCGCCACAGCATGGAACTCACCAGATGGTGACTTTGCCAGCGAATCTCCCAGAGCATGAG
Type
EST
SNP
Sequence
NSFT03P2_Contig18083
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01