Query (optional)   in Class  

GrainGenes Probe Report: BG274948-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG274948-5D
Data at Wheat_SNP
BG274948-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;C>T;DEL at 434;445;455-458
SNP T>C;G>C;G>A;T>A;C>T;DEL;G>A at 37;51;489;498;509;519-522;556
SNP A>G at 492
Reference sequence TCTGATTATGCGAAGAAAAACAACGTTAATACTTCTGCACTTACGCAATCTGAGATTCGTGATATAATACTTGGTGCTGAAATAGCTCCACCATCACAGCAGAGGCAACAGATTGCTGAGATTGAGAAACAGGTAAACTTTCTATACCACCCTTTGTGTCTAGTTTCTATGCATAGTAATTGCGTCAGTTTTCCTCATTCTTGGATTTGCTTGAATTTGCAGTCCCGAGAGACAAATCAGGTAACTGCACAGACAACAAGGACAGTTAATGTGCATGGAGATGAGCTCATCGTCACAACAACCAGTCCGTATGAGCAAGCAGCGTTTGCATCGAAGACAGATTGGCGTGTCAGGGCCATCTCTGCTACGAACCTGTATCTCCGTGTCAACCACATTTATGTTAACTCGGATGATATAAAGGTCAGTACTGCAATTTCTTTTCTTCGATTTACCCATAAAACCACCAAATAACAATTGTCCAATGGTTACTTACTGCTTGTATTATGTGTACAGGAGACTGGCTATACTTACATCATGCCAAAGAATATATTGAAGAAGTTCATATGCATAGCAGATCTGCGGACACAGGTTGCAGGTTTCCTGTATGGGCTGAGTCCACAGGATAATCCCCAAGTCAAGGAGATCAGATGCATATCCATTCCGCCACAGCATGGAACTCACCAGATGGTGACTTTGCCAGCGAATCTCCCAGAGCATGAGTTCCTTG
Reference sequence CTGGCCATCTTTGACCGACGAGCAGTGGCTGAAGGTTGAATGTGCGCTCAGGGATCTCATTCTTTCTGATTATGCGAAGAAAAACAACGTTAATACTTCTGCACTTACGCAATCTGAGATTCGTGATATAATACTTGGTGCTGAAATAGCTCCACCATCACAGCAGAGGCAACAGATTGCTGAGATTGAGAAACAGGTAAACTTTCTATACCACCCTTTGTGTCTAGTTTCTATGCATAGTAATTGCGTCAGTTTTCCTCATTCTTGGATTTGCTTGAATTTGCAGTCCCGAGAGACAAATCAGGTAACTGCACAGACAACAAGGACAGTTAATGTGCATGGAGATGAGCTCATCGTCACAACAACCAGTCCGTATGAGCAAGCAGCGTTTGCATCGAAGACAGATTGGCGTGTCAGGGCCATCTCTGCTACGAACCTGTATCTCCGTGTCAACCACATTTATGTTAACTCGGATGATATAAAGGTCAGTACTGCAATTTCTTTTCTTCGATTTACCCATAAAACCACCAAATAACAATTGTCCAATGGTTACTTGCTGCTTGTATTATGTGTACAGGAGACTGGCTATACTTACATCATGCCAAAGAATATATTGAAGAAGTTCATATGCATAGCAGATCTGCGGACACAGGTTGCAGGTTTCCTGTATGGGCTGAGTCCACAGGATAATCCCCAAGTCAAGGAGATCAGATGCATATCCATTCCGCCACAGCATGGAACTCACCAGATGG
Type
EST
SNP
PCR primers
BG274948_cpR1 GCTCCAAGTCAGCAAGGAAC
BG274948D_F1 ATCTCATTCTTTCTGATTATGCG
Sequence
NSFT03P2_Contig18083
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01