Query (optional)   in Class  

GrainGenes Probe Report: BG274985-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG274985-5B
Data at Wheat_SNP
BG274985-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;G>T;C>T;G>A at 137;187;461;665
SNP G>A at 665
Reference sequence TGCCATGGTGCCGAGCTAGGTGAGGCGCAAAACAGTTGCTAGTGGTGCTAGCGGGGAAGGCGTCGGAGTTGTGTTTACTGCAGGAGGAGTGGAGGGGCACAAGGGTCCCGTGGGTCCAGAAGGCTAGTGTGGTGACGTCGATGGAGGGAAATGCCTCTCGTGATGGACCTTGGGAAAGGAGGTGGCGGTGTGGAGGTCGGATGGTTACTGAAGCTCGCATCAACGCAAACACCCTCGGGCAGCCCTGCTGTGTACAGAATTGCTGGGACGGGATTTGTCGGTGAGTAAGTGTACCCACTCGGAGGAGGATCGCATACAGGCGTATCCCGGCCATATCACCGGCCCAAGCGTCCAAGGGAACTACATTTCAATACAAATTGAATGGTATAAGTTTTGTGATGCATAAACCATGTTTTCTTGGTCAAATTGATGGTCAACGCCGAATCTCAAAATACATGCACGGTATGTAAATAGGGACGGAGGGAGTTTATTTTATGTAACTAAAAATATGATGAAATTCCTTGACTACTCCTATGTCTATCAATATTGTACTCCCTCCATTCCCTTATACAAGGCCACAAACTCAAATTACAGGTACCTAGGTAAAATTTAATGACTATTTTGCAAGCCAACTTTTCTTCTTGTTATATGGGATCATTAATACGTCCGCATGCATGCAAGGAAGGAATGAGAAAGAAGTAGCACAATGTCATTATGACTACATGCATGTAAGTATTAAATAAGTTGCTAGTACGAGAAAACATCATTGAATTTTGCCTCGGTTACTGTTGGTGGCCTTGTATAGATGCAAAATGTATTTTTCATAGTGGCCTTGTATAAGGGAATGGAGGGAGTATCATCGCTTTAGAGTTCCAGTTTGTGGCTTATCTGCATGTAATGCTTACACTACAGATATGATAAATATAGACATAAAGAATAGACAAATATAGAAGAGAAACCCGGCACCATGCAATGAATTATACTAAAATCTTAATACCAG
Type
EST
SNP
PCR primers
BG274985B_F2 CCTGACGATGACGTTCAGG
BG274985_cpR1 CGGGAGCGTATAGTGAGAGC
Sequence
NSFT03P2_Contig8327
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01