Query (optional)   in Class  

GrainGenes Probe Report: BG275030-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG275030-2A
Data at Wheat_SNP
BG275030-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 74,1
SNP at
SNP G>A;A>G;A>C at 35;88;103
Reference sequence AATCCTACCCATAACTTCGGATATTTCCATATCTGCCATGACAAAATGATGACTGAAGCGTCAGAAATGAAAAAAAAAACCATTGTAACTGAATTCATGCCCAGCACAAAAATGAGCACCTGCTTGCTAACAAGGCGTGACATGATCTCCATCACAAAATCCACCTGAAAGGAAGTCTCACTATCAGGTTACAATATAACGGGTAACAAATCAGCAAAACTGGGAGCTGTTGACTTGAGCAAAACTGAGAACTGTTGACTTCAGCATGATAATAATGCATAAACCACACCAAGATCATCCATATCCACATATATACTTCGTGCCAGGGAAGTCTCT
Reference sequence GAGGCTTTGTCAGGATAGCACACTTCAGGAATCCTACCCATAACTTCGGATATTTCCATATCTGCCATGACAAATGATGACTGAAAAGCGTCAGAAATGAAACAAAAAACACTAACTGAATTCATGTCCAACACAAAAGTGAGCACCTGCTTGTTAACAAGGCGTGACATGATCTCCATCACAAAATCCACCTGCAAGGAAGTCTCACTATCAGGTTACAATATACCGGGTAACAAATCAGCAAAACTGAGAGCTGTTGCCTTCAGCAAAACTGAGAACTGTTGACTTCAGCATGATGATAATGCATAAACCACACCAAGATCATCCATATCCACATATATACTTCGTGCCAGGCAAGTCTCTCGCATGCTAGATTAGAGCATGAGGTACATAAGCCATATTTCTGACACAAAATGGGTTCAGACAATTGGCTTACCAAGGCAGGAAATGCACTTATCGCTTGCATAACAGTTCG
Type
EST
SNP
PCR primers
BG275030A_R1 TAATCTAGCATGCGAGAGACTTC
BG275030_cpF1 GGACTGAGGCTTTGTCAGGA
Sequence
NSFT03P2_Contig11068
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01