Query (optional)   in Class  

GrainGenes Probe Report: BG275030-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG275030-2D
Data at Wheat_SNP
BG275030-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;T>C at 88;175
[ Show all 7 ]
Type
EST
SNP
PCR primers
BG275030_cpF1 GGACTGAGGCTTTGTCAGGA
BG275030D_R1 TTGTGTCAGAAATATGGCTTATGTTT
Sequence
NSFT03P2_Contig11068
Linkage Group
2D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01