Query (optional)   in Class  

GrainGenes Probe Report: BG275102-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG275102-4A
Data at Wheat_SNP
BG275102-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;T>C;T>C;G>C;A>T;A>T;C>T;T>A;G>C;A>G;T>G;INS;T>A;A>G;T>G at 35;41;42;43;44;45;46;64;85;114;185;293,1;382;486;531
[ Show all 6 ]
Type
EST
SNP
PCR primers
BG275102A_R1 AAGCAACTATCACGTTCATAAAGAATC
BG275102_cpF1 CAACTGGACACAGATGGTGG
Sequence
NSFT03P2_Contig8758
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01