Query (optional)   in Class  

GrainGenes Probe Report: BG275108-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG275108-3D
Data at Wheat_SNP
BG275108-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;T>C at 244;265
SNP G>A;T>C;A>G;T>C at 206;227;296;380
Reference sequence TGATCGAGGTTTGGTTTCCATGCCCAACCTAGTCACTGGAGACGAGCCGGAGCATGACCAGGACGAGGATGACAAGGAGAAAGACGATGATCAGGATGACGGCGAGAAGCCCCCGAAATCCAGCCTTCCCCTCACAGTCACCATCACCAAGAGCGACGGTCCAAGTCTCGAATTCACCTGCACCGCCTATCCTGACGAGATCCTCATCGATACCTTGTCCGTGAAGCAGCCCTCTGAGAAATTGGAAGAGGACTACATTGCATATGAGGGTCCTGACTTCAAGTAAGAACACAAACCATGGCTTGGCCATTTTAATATCTTGGGTAACTGGAACGTGC
Reference sequence GAGACGAGCCGGAGCATGACCAGGACGAGGATGACAAGGAGAAAGACGATGATCAGGATGACGGCGAGAAGCCCCCGAAATCCAGCCTTCCCCTCACAGTCACCATCACCAAGAGCGACGGTCCAAGTCTCGAATTCACCTGCACCGCCTATCCTGACGAGATCCTCATCGATACCTTGTCCGTGAAGCAGCCCTCTGAGAAATTGGAAGAGGACTACATTGCATATGAGGGTCCTGACTTCAAGTAAGAACACAAACCATGGCTTGGCCATTTTAATATCTTGGGTAACTGAACATGCTTACCCGTCGCTGCTTGCTGATGTTGTATGCTTGGTCTTTGTGACGTGCAGTGACCTGGACGAGAACCTGCAGAGGGCATTCCACAAGTACCTGGAGCTGCGCGGGA
Type
EST
SNP
PCR primers
BG275108_cpF1 GATCGAGGTTCTGGTTTCCA
BG275108D_R2 GCACGTTCAGTTACCCAAGAT
Sequence
NSFT03P2_Contig14378
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01