Query (optional)   in Class  

GrainGenes Probe Report: BG313767-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG313767-1A
Data at Wheat_SNP
BG313767-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T at 52
SNP INS;A>G at 15,1;209
Reference sequence ATCTGATAGCCTTCCTTGGTTGATGGTACTGCAGTCAATCCATAGCCCTCTGAGTAAAACATAGCCTCAATAATTTATTTTCTATTTGGCTGGGCGGTTGCTCAGGGTTTAAGTTATGGTACAAGTTTTTTACCTCAAGTGCTTCCAATGTTTTTCCATTCAGCTACTTTGCCCCCGAATCTTACGGCAATGCACTTTTCTATGCAATACAGTAAATGTTTCACTGCTTAATCTGCCATGTTGGGTTAAACATTTGCCTTTATACCTATCTGCAGTTCATTATGAAGGGACACTTGCTGAAAATGGCGAAGTTTTTGACA
Reference sequence TCTGAGTAAAACACAGCGTCAATAATTTATNTTCTATTTGGCTGGGCGGTTGCTCAGGGTTTAAGTTATGGTACAAGTTTTTTACCTCAAGGTGCTTCCAATGTTTTTCCATTCAGCTACTTTGCCCCCGAATCTTACGGCAATGCACTTTTCTATGCAATACAGTAAACGTTTCACTGCTTAATCTGCCATGTTGGGTTAAACATTTGCCTTTATACCTATCTGCAGTTCATTATGAAGGGACACTTGCTGAAAATGGCGAAGTTTTTTGACACA
Type
EST
SNP
PCR primers
BG313767A_F3 CCTCTGAGTAAAACATAGCGTC
BG313767_cpR1 GAGGCGTTCTTAAGACGGTG
BG313767_cpR1 GGTGTCAAAAACTTCGCCATBF474569-1A
PCR_primers
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01