Query (optional)   in Class  

GrainGenes Probe Report: BG313767-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG313767-1B
Data at Wheat_SNP
BG313767-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 178
SNP T>C at 105
SNP C>A at 24
Reference sequence GATGGTACTGCAGTCAATACATAGCCCTCTGATCTGAGTAAAACATAGCCATAAATAATTTATTTTCTATTTGGCTGGGCGGTTGCTCAGGGTTTAAGTTATGGTACAAGTTTTTTTCTCTCAAGTGCTTCCAACGTTTTTCCATTCGGCTACTTTGCCCCCGAATCTTATGGCAATGCACTTTTCTATGCAATACAGTAAACGTTTCACTGCTTAATCTGCCATGTTGGGTTAAACATTTGCCTTTATACCTATTTGCAGTTCATTATGAAGGGACACTTGCTGAAAATGGCGAAGTTTTTTGACA
Reference sequence CTTAAGACGGTGGTCAGAAAAGCCAAGGATGATGCTATAAGCCCATCTGATAGCCTTCCATTGGTTGATGGTACTGTACTCAATGCATAGCCCTCTGAGTAAAACATAGCAATAAATAATTTATTTCTATTTGACTGGGTGGTTGCTCAGGGTTTAAGTTATGGTAGAAGTTTTTTCTATCAAGTGCTTCCAACTTTTTTTCATTCGGCTACTTTGCCCCCCGAATCTTACGGCAATGCACTTTTCTATGCAATACAGTAAATGTTTCACTGCTTAATCTGCCATGTTGGGTTAAACATTTGCCTTTATACCTATTTGCAGTTCATTATGAAGGGACACTTGCTGAAAATGGCGAAGTTTTTGACA
Type
EST
SNP
PCR primers
BG313767B_F3 TGATGCTATAAGCCCATCTCAC
BG313767_cpR1 GAGGCGTTCTTAAGACGGTG
BG313767_cpR1 GGTGTCAAAAACTTCGCCATBE403420-1D
PCR_primers
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01