Query (optional)   in Class  

GrainGenes Probe Report: BG498351-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG498351-6D
Data at Wheat_SNP
BG498351-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;INS;G>A at 47;100,5;137
SNP INS;G>A at 100,5;137
Reference sequence TGTAACGGAGGGAGTACTTGTATTAGGTTGTTGTACTGTCCTAAAAGGTGTAGTTAAGGTTTCCTAAAAACTGTGGTTAAGGTCATATATAGTTTGTTATCCTTTTAACAAGGCTCTTCTTTATGTCTTGTTTCAAGTATTCAATTAGTTATCAATCTGGATGATGACTTGTGTGGCACAAATTGGCTGCAGCTAACAGAGGACTGGGGGGAAGTGCTCTTCTCTGCGCTCAAGCGCGCTGGCGGGACAGCCTTCAGCAACATGGCCGTCGGTTACAACAACGTCGACGTAGATGCTGCCAACAGGAATGGCATCGCCATCGGCAACACGCCTGTATGTAGCACATGGAATTTATTTGACTGACAAGTGCCTTTGATATGATGAATGTTGCTCTGAAGTCTGAATCTCGTGATTACCATGATGGATGGGTGTATGCAGGGTGTTCTTACTGAGACGACGGCGGAGCTAGCGGCATCGCTGTCGGTGGCGGCTGCCCGGAGGATCGTTGAGGCCGACCAATTCATGAGGGCTGGCCTCTACGACGGATGGCTCCCGCACCTGTGAGTGATTGACTGCT
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01