Query (optional)   in Class  

GrainGenes Probe Report: BG604577-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG604577-3A
Data at Wheat_SNP
BG604577-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>C;A>T;C>T;G>A;T>C;T>C;T>A;A>C;A>G;T>C at 50;235;246;281;286;318;339;361;381;439;548
SNP T>C at 219
Reference sequence GCTTTCCAAGTAATCCGGAAACTTTCCTTTTGGATGCTCTTCATTCCAGTGGCTATTCTGGTGCCTTGGCAAACCCATTGATTGCCTCAGAGGCTTCAATTAGCAGATTAAATACCGATGTTCTGGAAGAATTTCTTGCTGTGAGATTCATGCCCTAAAATTCTGTTAGTACTATAGTCGTGTGGGTATTCTTGTTAACATGCTATCTATATTTCTGTTGCATGTATGTCAGTTGAACTACACTTCCCCGCGAATTGTTCTAGCTGCGTCTGGTGTGGACCACGATGAACTTGTATCAATTGCTGAACCACCTCCTGTCT
Reference sequence TAGGTGGCAGTGCGAAAGCATCAGCCAACCGTGAGCTCATGAGCTACAGCTATGGAGCCCTTAAGACTTACATGCCTGAAATGGTGGAAGTGCTAGTTGATTGTGTGAGAAATCCTGCTTTACTTGATTGGGAAGTCAAGGAAGAGGTATTTCAGCTTAATATTATGCCCTTTCGCTTCTGTACTATAGATTAGTGGAATATGTTCTTTGCTGAATGCAAACTTATTGACTTTGTAGATAATGAAACTAAAGGCAGAGCTTGCAGAAGCTTCAAGTAATCCGGAAGCTTTCCTTTTGGATGCTCTTCATTCCAGTGGTTATTCTGGTGCCTTGGCAAATCCATTGATTGCCTCAGAGGCTTCAATTAGCAGATTAAATACAGATGTTCTGGAAGAATTTCTTGCTGTGAGATTCATGCCCTAAAATTCTGTTAGTACTATAGTCGTGTGGGTATTCTTGTTAACATGCTATCTATATTTCTGTTGCATGTATGTCAGTTGAACTACACTTCCCCGCGAATTGTTCTAGCTGCGTCTGGTGTGGACCATGATGAACTTGTATCAATTGCTG
Type
EST
SNP
PCR primers
BG604577A_F1 GAAGCTTCAAGTAATCCGGAAA
BG604577_cpR1 CAGACAGGAGTGGTTCAGCA
Sequence
NSFT03P2_Contig18464
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01