Query (optional)   in Class  

GrainGenes Probe Report: BG604577-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG604577-3D
Data at Wheat_SNP
BG604577-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T at 160
SNP A>T;A>G;C>T;A>G at 260;428;525;560
SNP A>T;A>G at 269;437
Reference sequence GGTTCGTGAAATTGGTGCAATAGGTGGCAGTGCGAAAGCATCAGCCAACCGTGAGCTCATGAGCTACAGTTATGGAGCCCTTAAGACTTACATGCCTGAAATGGTGGAAGTGCTAGTTGATTGTGTGAGAAATCCTGCTTTACTTGATTGGGAAGTCAAGGAAGAGGTATTTCAGCTTAATATTATGCCCTTTTGCTTCTGTACTATAGATTAGTGGAATATGTTCTTTGCTGAATGCAAACTTATTGACTTTGTAGATAATGAAACTAAAGGCAGAGCTTGCAGAAGCTTCAAGTAATCCGGAAGCTTTCCTTTTGGATGCTCTTCATTCCAGTGGCTATTCTGGTGCCTTGGCAAACCCATTGATTGCCTCAGAGGCTTCAATTAGCAGATTAAATACAGATGTTCTGGAAGAATTTCTTGCTGTGAGATTCATACCCTAAAATCCGGTTAGTACT
Reference sequence AATTGGTGCAATAGGTGGCAGTGCGAAAGCATCAGCCAACCGTGAGCTCATGAGCTACAGTTATGGAGCCCTTAAGACTTACATGCCTGAAATGGTGGAAGTGCTAGTTGATTGTGTGAGAAATCCTGCTTTACTTGATTGGGAAGTCAAGGAAGAGGTATTTCAGCTTAATATTATGCCCTTTTGCTTCTGTACTATAGATTAGTGGAATATGTTCTTTGCTGAATGCAAACTTATTGACTTTGTAGATAATGAAACTAAAGGCAGAGCTTGCAGAAGCTTCAAGTAATCCGGAAGCTTTCCTTTTGGATGCTCTTCATTCCAGTGGCTATTCTGGTGCCTTGGCAAACCCATTGATTGCCTCAGAGGCTTCAATTAGCAGATTAAATACAGATGTTCTGGAAGAATTTCTTGCTGTGAGATTCATACCCTAAAATCCTGTTAGTACTATAGTCGTGTGGGTATTCTTGTTAACATGCTATCTATATTTCTGTTGCATGTATGTCAGTTGAACTACACTTCCCCGCGAATTGTTCTAGCTGCGTCTGGTGTGGACCACAATGAACTTGTATCAATTGCTG
Type
EST
SNP
PCR primers
BG604577_cpF1 CGTGTTGTTCGTGAAATTGG
BG604577D_R2 CCACACGACTATAGTACTAACCGG
Sequence
NSFT03P2_Contig18464
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01