Query (optional)   in Class  

GrainGenes Probe Report: BG604817-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG604817-5D
Data at Wheat_SNP
BG604817-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;G>A;DEL;T>A;INS at 62;136;269-270;639;751,1
[ Show all 6 ]
Type
EST
SNP
PCR primers
BG604817_cpR1 CTTCCACGGTGGTTGAAGAT
BG604817D_F2 CACAAGTCAGACATGGGATTG
Sequence
NSFT03P2_Contig17329
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01