Query (optional)   in Class  

GrainGenes Probe Report: BG605554-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG605554-5A
Data at Wheat_SNP
BG605554-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>T at 463;473
Reference sequence GCCTTTTCGACAGTCCATATTACCTTGTAATCAAGTTACCTTTGTAACCAAGTGAACATATTTTACAATTTGTAATTCTTTATCCTTATGTGCAGGTTCCGTACCAGACAAATAAATCTACTCTAGTCCAAAGGATAGCGGAGCTTGTTGAAGACAAGGTAACTTCATTTGGGACATAATTAGTTATTTTTTATTACTCGTGCTGTAGCCTTTTGGTGTTTGGGTTTATCCATAAAAAAACAGGACGTAAGTTAGTTGGTTGGCTGTAACTTAAGCTTAATTTGAATTCTGTCATTGATACCACCACTATGAACCACCAACCCATTTTTGGTACTAAGTGCAGGTGTTAGAAGGCATCAGTGATATTCGGGATGAAAGTGACCGTGCTGGAATGCGTGTAGTTATCGAGGTTTGTACTATCATCTTTGACTTTATGTGCTGAGCTTATCTTTATCATTTAAGGCTGAAATTACGGGTCCAAGGATATTAGTTGTCTTGTTGCTTATGTGGAATCCATTACCTTCTCTTTCATACCGTTCCAGGTGAAAAGAGGTGCAAATCCTGCCATTG
Type
EST
SNP
PCR primers
BG605554A_F1 TTTTCAGAGCAATGCCTTTTCGA
BG605554_cpR2 CAGGTTGTTCAGGACAATGGC
Sequence
NSFT03P2_Contig5144
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01