Query (optional)   in Class  

GrainGenes Probe Report: BG605554-5B

Probe
BG605554-5B
Data at Wheat_SNP
BG605554-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;DEL at 184;450
SNP INS;G>A at 194,3;300
SNP A>T at 151
Reference sequence CAAGTTTACCTTGTAACCAAGTGAACATATTTTACAATTTGTAATTCTTTATCCTTATGTGCAGGTTCCGTACCAGACAAATAAATCTACTCTAGTCCAAAGGATAGCTGAGCTTGTTGAAGACAAGGTAACTTCATTTGGGACATAATTAGTTGCATTTCTCCTGTATCAGGAATACTATTTTTTATTATTTGTGTAGCCTTTTGGTATTTGGGTTTATCCATAAAAAAACAGGACGTAAGTTAGCTGGTTGGCTGTAACATAAGCTTAATTTGAATTCTGTCATTGATACCACCACTGTGAACCACCAACCCATTTTCGTTACTAAGTGCAGGTGTTAGAAGGCATCAGTGATATTCGGGATGAAAGCGACCGTGCTGGAATGCGTGTAGTTATCGAGGTTTGTACTATCATCTTTGACTTTATGTGCTGAGCTTATCTTTATCATTTAAGACTGAAATTACGGGTCCAAGGATATTAGTTGTCTTGTTGCTTATGTGGAATCCATTACCTTCTCTTTCATACCGTTCCAGGTGAAAAGAGGTGCAAATCCTGCCATTGTCC
Type
EST
SNP
PCR primers
BG605554B_F1 TACCTTGTAATCAAGTTTACCTTG
BG605554_cpR2 CAGGTTGTTCAGGACAATGGC
Sequence
NSFT03P2_Contig5144
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01