Query (optional)   in Class  

GrainGenes Probe Report: BG606625-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG606625-2A
Data at Wheat_SNP
BG606625-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;G>A at 70;92
SNP G>T;A>G at 70;617
SNP G>T at 70
SNP G>T;A>G;T>C at 70;617;620
Reference sequence TTCATGACATTCTTATGACTTAACTAATGCCCATACTTTAATCCCAATTTTGCAGAAAAAGTTCAATGAGGCACTCATGGGAATTCTCCGAGTTCGTAATTTGTGCAGCCCGCCTTACGTATATACAAATCCACACACACTGAGTCACAAGGTTATGGAAGACGATCTGTTTGTTGTGCTTGGCAGTGATGGCTTATTTGATTTCTTCAGTAACGATGAAGTTGTTCAGTTGGTTTATCAATTTATGCATGATAATCCAACTGGCGATCCTGCAAAATATCTCATCGAGCAAGTTGTACATAAAGCTGCCAAAGAAGCAGGTATCCCCTAAATATATCAAATTTATTTTTTTGATACACAAATAATTAGCATTAAGAGTCTATAGAAGACCCTTTGTGATTGGTAATGAACAACCCAATTGTAGAAACACCTTTCTCATGTTATAATAGGAAGGCAAGTACCCCCTTAACTCCTGCCAAGTGAGTAAAAGCTCTGTGATACCAAGTAACAACCAAACATGTTTTAACTTAAAAGTATGTCATTGATGTCAGATAGCTATTTATAGGCTTGTAGAAAAATTATAAGTCCCTCCTTTTTTTTATGGTTTAGACTTTAGACATGCATATATCATAACAATAACATCAGATGAGAATGAAGAGGCAGTATGTGTGAGAGTACATTTACGTTGATTAATTGTTTTGATTTTTGTAACTAGAGTACCATCTTGGCAACCCTTTTGGGGAACCATAGCTGTAAGCAAGTAAAACTAACACCAACTCTTCACTAATTTCTTCCTATGCCTTGTCAGCT
Type
EST
SNP
PCR primers
BG606625A_F1 GGCTACCTTAAACAGGTACCATA
BG606625_cpR1 CTTTCTCCTGCTCCCAACAG
Sequence
NSFT03P2_Contig3247
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01