Query (optional)   in Class  

GrainGenes Probe Report: BG606668-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG606668-2B
Data at Wheat_SNP
BG606668-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 168
SNP at
SNP G>T at 7
Reference sequence CTGCATTCTGAACCCAGGACGGACCGCATCAACGCGGGCCTGAAGCTGGCGGTGGCCATCGCGCTGCCGGTGCTGTTCGGGCTGTGGCTGGGCCTGGGCATCTTCGGGAGCGCCCTGGTGGCGCTGGGCTACGGCTTCTTCACGCCGTGGATCTCCACCTTCGAGGCGTTCCGGCAGGAGAGCGAGGCCAAGAAGTTCGTGCATGGCATTGTGGTAAGCTCAAACTTCAAAGGGACGACCGGCCGCTGTTAACTGTGAAAACTGAGTGAGAGATCGACGGTTGATTTCGGTTTCTC
Reference sequence GCTGCCGGTGCTGTTCGGGCTGTGGCTGGGCCTGGGCATCTTCGGGAGCGCCCTGGTGGCGCTGGGCTACGGCTTCTTCACGCCGTGGATCTCCACCTTCGAGGCGTTCCGGCAGGAGAGCGAGGCCAAGAAGTTCGTGCATGGCATTGTGGTAAGCTCAAACTTCAAAGGGACGACCGGCCGCTGTTAACTGTGAAAAGCGAGTGAGAGATCGACGGTTGATTTTGGTTTCGCCGGGTGCAGGACGGGACGTGGGGGACGATCAAGGGCAGCTGCACGGTGGTGAGGGACTTCGCGGACATGTGCTTCCACTCCTACCCCGTT
Type
EST
SNP
PCR primers
BG606668B_R1 CGTACCAGCGAGAAACCG
BG606668_cpF1 CTGCATTCTGAACCCAGGAC
Sequence
NSFT03P2_Contig13371
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01