Query (optional)   in Class  

GrainGenes Probe Report: BG606668-2D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG606668-2D
Data at Wheat_SNP
BG606668-2D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>G;A>C;A>T;C>A;G>C;G>C;G>C;INS at 8;12;19;23;30;34;55;66;310,1
Reference sequence CTGCATTCTGAACCCAGGACGGACCGCATCAACGCGGGCCTGAAGCTGGCGGTGGCCATCGCGCTGCCGGTGCTGTTCGGGCTGTGGCTTGGGCTGGGCATCTTCGGGAGCGCCCTGGTGGCCCTGGGCTACGGCTTCTTCACGCCGTGGATCTCGACCTTCGAGGCGTTCCGGCAGGAGAGCGAGGCCAAGAAGTTCGTGCATGGCATTGTGGTAAGTTCAAAAGGGACGACCGGCCGCTGTTAGCTGTGAAAAGTGAGTGAGAGATCAATGGATGATTTTGGTTTCTCGCCGGGTGCAGGACGGGACGGGGGAAC
Reference sequence CTGTGGCTTGGGCTGGGCATCTTCGGGAGCGCCCTGGTGGCCCTGGGCTACGGCTTCTTCACGCCGTGGATCTCGACCTTCGAGGCGTTCCGGCAGGAGAGCGAGGCCAAGAAGTTCGTGCATGGCATTGTGGTAAGTTCAAAAGGGACGACCGGCCGCTGTTAGCTGTGAAAAGTGAGTGAGAGATCAATGGATGATTTTGGTTTCTCGCCGGGTGCAGGACGGGACGTGGGGAACGATCAAGGGCAGCTGCACGGTGGTGAGGGACTTCGCGGACATGTGCTTCCACTC
Type
EST
SNP
Sequence
NSFT03P2_Contig13371
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01