Query (optional)   in Class  

GrainGenes Probe Report: BG606710-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG606710-6D
Data at Wheat_SNP
BG606710-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;C>T;A>G;G>A;C>T;A>G;A>C;A>G;INS;G>T;C>A;C>T;G>A;A>G;C>A;A>G;A>G at 177;189;198;213;219;358;370;372;379,1;391;392;403;407;408;414;416;424
SNP DEL at 353
Reference sequence GCACGCCTTAGCATGTAAAACCAATGCACAGCGAAATTGTTACCTTCCCGGCCTTCATCGTCAGCGTCATTTGTGCCGCCTCCTGAAACTTTACAGTATGAGATGATCAAGTCCTGGTCGGCGGTGATGTATATATTATTGGTGTTGCAGTTGGGATGCCACAACTCATGGTCATCGAATGATGTAACCAGCTCTCCACGGAAATTCCAAGCGGCAACCGTTCTATTGCAGAATGTCAGGAACAGATTATTTTCATACAGGAAGATGAACGCTGAAGGGGTCATGAACTCTGTTTTGTTCACCTCAATCAGACCAGAGTTTCTGACCTGCCCAGAGACCAAAGTTAGCTCATAGTTCACTGCTAAGAAAACATTAGCTCAAATTAAGGTAGCAATGTAGCTGCCACGAGTAGACAAAATAATAATAGCAACGTACATCAATAATCTGCAGGTTTTCCTTGTCTTGCTTCACAAGAAGTTTTTCGTTAAACTGCTCAATGAAGTCAACC
Type
EST
SNP
PCR primers
BG606710_cpF1_UCD TGCTGCATCGAAACAGAAAG
BG606710D_R1_UCD GAAGCTATACTGAATACAGCACGC
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01