Query (optional)   in Class  

GrainGenes Probe Report: BG607230-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG607230-1A
Data at Wheat_SNP
BG607230-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 527
SNP DEL;DEL at 195;527
Reference sequence AAATTNGATTTGCTGGCTACTAGGTAGAAAGTACTATACAGAACATCATACAAGGCATTTGCAACAAAGGTCCCCAAAAAGGGCTAATAATATAGTGCAGGTTTAAAATGGAATGGTACTCGACTATTCATGATATTTTGTCAATTGACTGGATATCAAAGCCTACAAATGCATTAGTTTCCATTTCATGGATTTTAAACTAAGGGATTCAATATGCAGCAAAACAGAAGGTACTTTGGAAACGAAGAGCGGGTAATAGTAATACACATCTAGCTTTACCATGTTTCAATGTAGATAAAAATTAAGGTTAGAATTACCGGTGATATAGTTGCAGAAGCTTCCCCAGAACCTTTACTTGCTAAGAAGATTGAACAGAGGAGTGGTATAACATCCCTCTGTGCCTTTTCACTCTGCGCATTCTTAGACAGATCCACAGAAACACGAGCAGATGCAAGCCGTACCCTACAGCCAGGTCATGAAATAATTTAGAACTAGACATTTGTTAGTTGGGATATATGACTGCTCCAGACCCGAAGGAACTAGCTGAAGCAGAACAGTAACACAGGCATGAATCAAACAAATGGAAAGGAAGAAAGTAACAGGCTTACCTATTAAGGCTATCCTTTTCCACGAGATTGACAAGCAGCCCCC
Type
EST
SNP
PCR primers
BG607230A_F2 CATACAATAGGATTTGCTGGCTA
BG607230_cpF1 CATATTGGGCTTGCTTGTCA
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01