Query (optional)   in Class  

GrainGenes Probe Report: BG607512-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG607512-5A
Data at Wheat_SNP
BG607512-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;C>T at 146;636
SNP T>A;A>G at 274;411
Reference sequence GCAGTCCTGCTGAATGCCAAATAAATAAGATAGTTGTCCATGTGAGAACGGTTGTCCAGATCAAGTCACATGCCTTTTGATTCATCAAGGGAAATCAAATTAGCATCAGATTTTAAATACATTGAAATTAGTGGAAGAAGCATATATTCCTTTGTCTTTTCACTCTGGAATGATATTAGAACCAGATTCTCCTTATTAGTTTTATTTATAATGGGTTGGGTAGACTTGTCAACACAGTTTCTAGCTCGAATATCAGTTATGCTGAGGGTACTTTGGAGAAGTCCCTTACTCATCATATATTTAGTCTATTATGAATGTGATGAAAACTTGGCTTTCTATTAGAATCGTTGGGTGGCAGCATGAAAAACTACATACTCTCTCCGATCCGAATTAAATGACGCGGACTCTATACAATGTCCATTTTACATTGTACAGAGGTTGCGTCAATTAATTGAGACCGGAGGGAGTAATAGTTTCTCAATTTGTTGATACTGAAGCAGTTGTTTCAAGTCACGGAGGGAGTAGCAAAGTTCCACCCTCTTTAGCTAGGAAACTTCATTTATAGATTACACAGTACCCAATGTGTTCACATGATCATGTGTTTAAGCCTATGTTGGGTTCAATACTTATTGAGTCCATAGCCCCCGTTTGAGCATCTAATTAAAAAGTATGGATAGCTATGGACTTAAGCTACAAAGCAAGATGTAGAAAGTACTGAGACTTTCAGGTGTGTTCAGGCTAGGGAATTCGTTACTCTCTTTCAGAGTATTGTTTTATTTATATGTGGTTTTCAGTTACTGCAAACCGAAGTATTCAGTGTTATAGTGTACTATACTGTTATATAGTCATTCTGTGGACAAGAGCTTGGCTTCCAAACAAATATTGATAGAAGTTACATAACTGATAAGTGACTTAAGATTTAACTGATTTTTATCGCCATTTGTCGTTTCTATCCAGGTTGTTTCAAGTCACGGAGGGAGTAGCAAAGTTCCACCCTCTTTAGCTAGGAAACTTCATTTATAGATTAC
Type
EST
SNP
PCR primers
BG607512A_F1 ATTGTTCCTCCTTTGGGACA
BG607512_cpR2 TGACAGCTTGTACCGTTCATC
Sequence
NSFT03P2_Contig13509
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01