Query (optional)   in Class  

GrainGenes Probe Report: BG607523-2,1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG607523-2,1A
Data at Wheat_SNP
BG607523-2,1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;G>A;G>A;A>G;C>G;G>A;A>T;T>C;T>G;INS;A>C at 71;91;112;222;417;515;656;939;1055;1063,1;1072
Reference sequence GACAAGAAAATCACACTTGTATATATCTGCAAAACTACCAGGTGATAATCATGAGGGGATACACGATCTCTTCTTTTTGGGCATGTCTTGGTTATACCAAATTTTGGCTTGGCAATGTGAGGGCAAGCCCAAAATTTGGTTACCATGGTGGGCTATCAGACCAAGATTGCTTAAAAAGACAAGATGATTTCTTCACTTTCCTATCTGGGTTAAATAGGATCATTTGATGAATCTTCCTTTTCCATTTATTTCTTAAATTCTAGGTTCTCCAGGCAAACCTACTACCCGATTCGTATCAGCCCTTCGAGTCTGCTGCAATCGTCAAATTCTTCTCAATCAGGGTAAGTAGGATGTGTAACTGTCATCTTCTCATCATCGCTACAATAATATTTGCCTAAAGATATGCTATTTGTTTTCTTTCTGTAGAAACCGCACAGCATGTTTCAAATGTTGTTACTTGGAAACGTTCAGTCTCGTCTCTATCATCGTCATCTAAAAGTCCACTTACAACTTCGATGATTCAAGATGATGTGGATGATAGTAATAATGATTTCATTGAGCAATTTGCTATGGTGTCTGGAAGCCATTCTTCTACATTGGATAGGCTACATGCATGGGAGAGAAAATTATATGATGAAATCAAGGTACATTTACAATATTTAAGGAAGCTTTCTAGTATGATGCGCCAATCATGAATTAGCCACTTCTCTAAAAATATGGCTGGTGTTTTGTTGTATGGCTCTAGTGAAACCTTCTTTTTAATCTTGTAGTTCTCAAGACTAAGTTTAGGAGGCAACTGCTGTATCTTGAAAGAATGGTTGTAAAATGTAGCAGGCATACTATTTTTGTTTCTACTAAACCTTGTTTTTAATCTTGGTAGTTCTCAAGACTAAGTTTAGGAGGCAACTACTGTATCTTGAAAGAATGGTTGTAAACTGTAGCAGGCATACTATTTTTGTTTCTGTTAATCGTAAAATTTGATTTGCTTAATACTACTTGGAGTGTAGATTGCATGTTGTATGTCAACTATAAAATAATGTAATAAAGGCTGTGATTTGTGAAATAGAGGCTACCAATTAAATGTGTCTGTTCTTGGCATAATGAGTCATTGAAACTGCA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01