Query (optional)   in Class  

GrainGenes Probe Report: BG607523-2,1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG607523-2,1D
Data at Wheat_SNP
BG607523-2,1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;C>T;C>A;G>C;G>C;T>C;G>C;G>A;A>G at 40;81;712;835;983;984;986;988;991
Reference sequence CTTGAGACAAAGAAGATCAGACTTGATATATCTGCTAAACCCCTGGTGATAATCATGAGGGGATACATGGTCCTGTCTTTCTGGGCATCTCTTGGTTATACCAAATTTTGGCTTGACAATGTGAGGCAAGCCCAAAAATTGGTTGCCATTTGGTAGGCTATCAGACCAAGATTGCCTAAAAAGACAAGATGATTTCTTCACTTTCCTATGTGGGTTAAATAGGATTGTTTGATGAATCTTCCTTTCCCATTTATTTCTTAAATTGTAGGTTCTCCAGGCAAACCTACTGCCCGATTCGTATCAGCCCTTCGAGTCTGCTGCAATCGTCAAATTCTTCTCAATCAGGGTAAGTAGGATGTGTAACTGTCATCTTCTCATCATCGCTACAATAATATTTGCCTAAAGATATACTATTTGTTTTGTTTCTGTAGAAACCGCACAGCATGTTTCAAATGTTGTTACTTGGAAACGTTCAGTCTCGTCTCTATCATCGTCATCTAAAAGTCCACTTACGACTTCGATGATTCAAGATGATGTGGATGATAGTAATAATGATTTTATTGAGCAATTTGCTATGGTGTCTGGAAGCCATTCTTCTACATTGGATAGGCTACATGCATGGGAGAGAAAATTATATGATGAAATCAAGGTACATTTACATTATTTAAGGAAGCTTTCTAGTATGATGCGCCAATTATGAATTAGTCACTTCTCTAAAACTAAGGAAGCTTTCTAGTATGATGCGCCAATTAAGGAAGCTGGTGTTTTGTTGTATCACTCTAGTGAAACCTTGTTTTTAATCTTGTAGTTCTCAAGACTAAGTTTAGGAGTCAAGTGCTGTATCTTGAAAGAATGATTGTAAAATGTAGCAGGCATACTATTTTTGTTTGTACTAATTGTAAAATTTGATTTGCTTAATACTAGTTGGAGTGTAGTTTGCATGTTGTATGTCAACTATAAAATAATGTAATAATGGTTGTGAGTTGTGAAATAGAGGCTACCAATTAAATGTGTCTTTTATTGGCATAATGAGTCACTGAAACTGCATTACTTGTTTA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01