Query (optional)   in Class  

GrainGenes Probe Report: BG608352-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG608352-5A
Data at Wheat_SNP
BG608352-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 295
[ Show all 6 ]
Type
EST
SNP
PCR primers
BG608352A_R1 TACTCATACACCAGTAGGTCAG
BG608352_cpF1 TCCACAATGCAGAGCTTGAC
Sequence
NSFT03P2_Contig13313
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01