Query (optional)   in Class  

GrainGenes Probe Report: BG608352-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BG608352-5B
Data at Wheat_SNP
BG608352-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>G at 81
SNP G>A at 261
Reference sequence AGCTTGACGGCGGTCGACTTCTCATACAACAACTTATCCGGGCTCGTCCCAGGGACCGGCCAGTTCAGCTACTTCAATGCCACATCTTTCGTTGGCAATCCAAACCTGTGTGGACCATACCTTGGTCCATGCCGCCCTGGCATTGCTGATGCTGGTCACACCAACCATGGCCATGGAGGGCTGTCTAGTACCATCAAGCTGCTCATTGTGTTAGGCTTGCTTCTTTGCTCCATTATATTTGCCACCGCGGCGATTCTGAAGGCGCGGTCGTTGAAGAAAGCCAGTGATGCACGGATGTGGAAACTCACTGCATTCCAGCGCCTTGATTTCACCTGTGATGATGTGCTCGATTCCCTGAAAGAGGAGAACATTATTGGCAAAGGCGGGGCTGGAACTGTGTACAAGGGATCAATGCCCAATGGTGATCATGTGGCCGTGAAGAGGCTCTCTGCAATGGTCCGTGGCTCATCGCGTGATCATGGATTC
Type
EST
SNP
PCR primers
BG608352B_R1 TGCTGAGAATCCATGATCACGC
BG608352_cpF1 TCCACAATGCAGAGCTTGAC
Sequence
NSFT03P2_Contig13313
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01