Query (optional)   in Class  

GrainGenes Probe Report: BI479113-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BI479113-5B
Data at Wheat_SNP
BI479113-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 6,1
SNP T>C at 17
Reference sequence CGAGCAGGACCGCCGCCCGCTCCTCGACCTCGGCCACCCGCTCCTCAACCGCGTCGCCGACAGCTTCATCCGCGCCGCCGGAGTACGTCCCCTTTTTAATCTCCACCCACCGTACACGCGTGCTCTGCTCCATCGTTTCTCTCCTGCTCCGTCGTGTGTTAACTGTTCTGACTGCTCCGGGCTGGTATGATGGCAGGTCGGAGCGGCGAGGGCGGTGTCGCGGGAGGCCTACTTCGTCGCCGTCGAAGGGGTGGGGGGAGACTCGACGGGGCTGGACAGCACCGCCAAGAGGAGCCATTTCTCGAGCGCCAGAGGTGGTACCTCTTTTCCGGACAGTACTACCTCTTTTCTCTCTGTTTTCGTTGAGCCCGAGCTGATGAAATCGACTATCCACAGGGGATGACGGCCAGAAGTCGCTCGACGCAGTGGTAAGCAAGGCTCAAATTATCTATTTCGATAGCTAGTTCTTCTCACTCTGACCACTAGCTCCCATCTTCATTTGCAGGTTAAATCGGCAAGCAAGGAGGCCATCCAGTGGGGTGAGAATTCATTTTAGCACCAACTAATTATTGTAGCTCAAAAATTATTTTACTACAGCTTGTAATATGTGTTGTTCTTCCGGCAGGATTGGCAGCCGGAGTCTACTCTGGGATAACGTACGGTCTGAGAGAGGCCAGAGGACACCATGACTGGGTTGGTTTCTTGATCTCCAAACTAATTTTCTACCTGCTGTTTCATATCAGCTAGGTTCAGAATTAACTGGCTGCTAACTAACTTGTGCTTGTTATCCTTGATGCTGCTGCAGA
Reference sequence CGTGCGATAACTGATCTGACTGCTCCGGGCTGGTATGATGGCAGGTCGGAGCGGCGAGGGCGGTGTCGCGGGAGGCCTACTTCGTCGCAGTCGAAGGGATGTGGGGAGACTCGACGGGGCTGGACAGCACCGCCAAGAGGAGCCATTTCTCCAGCGCCAGAGGTGATACCTCTTTCCTGGACAGTACTACCTCTTTTCTCTCTGTTTTCGTTAAGCCCGAGCTGATGAACTCGACTCTCCACAGGGGATGACGGCCAGAAGTCGCTCGACGCAGTGGTAAGCGAGGCTCAAATCATCTGTTTCGACAGCTAGTTCTTCTCCCTCTGACCACTAGCTCGCACCTTGGTTTGCAGGTTAAATCGGCAAGCAAGGAGGCCATCCAGTGGGGTCAGTATTCATTTCAGCGTTAACTAATTATTGTAGCTCAAAAATCATTTTAGCACAGCTTGTAATATGTATTGTTCTTATGGCAGGATTGGCAGCCGGAGTCTACTCTGGGATAACGTACGGTCTGAGAGAGGCAAGAGGACACCATGACTGGGTTGGTTTCTCGATCTCCAGACTAATTTTCTACTTGCTGTTTCAGATCACGTAG
Type
EST
SNP
PCR primers
BI479113X_F2 CTCCGTCGTGCGATAACTGA
BI479113X_R1 AATTCTGAACCTACGTGATCTG
Sequence
NSFT03P2_Contig14679
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01