Query (optional)   in Class  

GrainGenes Probe Report: BI479207-5,4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BI479207-5,4A
Data at Wheat_SNP
BI479207-5,4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;A>T;C>G;A>G;G>A;T>A;A>T;C>G;A>G;A>G;T>G;T>A;A>C at 276;396;404;410;411;412;413;436;463;476;517;675;680
Reference sequence AAGCAGTTAAACCATAAGAAAACAAGACAAGACAAGACAAGAGACAAGACAAGAGACAAGACAAGAGACAAGACAAGCAGAGATAATTCTTGAGCTTAACATACATCATCTGGACGATTGATATCAACATTGTAGAGCAATAGCGTTTTTATAGTCTGATTGCATGCTGTTTGGACAGCATAATGCATTAGGGTTGCACCATCCTGTAACACCGAAGTTGCACCGTTGAGTTAATGGAATTAAAAAATTCAAATACAGAAGGAATCTACTCCCTCTGTTCCGAATTACTTGTCTTGGATTTGTCTAGATACGGATGTATCTAGACTCATTTTAGTGCTAGATACCTCCGTATCTAGACAAATCTAAGACAAGTAATTCGGAACGGAGGGAGTAGAAGCTAACCCGCTGCAGTAATGCCTACAGGAAGTGATATACCTTAACACAAAATAGAAGAACCAATGCAAATATCTAAAGAACAAAACTGAAAACAAACAACATCAACATATTATTCAAGATTAACCCCATCATGAAAGCAAACAACATCACCATATAATCCAAGATTAACCACATGTAATATAACAGAACATTCTTGGAATTTGCTATTTAAAACTGTTTCAAAGATATGTAAACATAGGATATACTCACTCTATCACAGACAGATGGATTTGCTGAATTCCTTAAGAGATAGTTGATGATAGCATGCTTCTTCGAAATAATTGCTTT
Type
EST
SNP
Sequence
NSFT03P2_Contig1373
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01