Query (optional)   in Class  

GrainGenes Probe Report: BJ277289-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BJ277289-6A
Data at Wheat_SNP
BJ277289-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>G;C>T at 495;542
Reference sequence TATTTTGGATTTGTCTAATCAAGGTCATTTGCAATGGTGAGATACCATTCACTGGTTTGGTGGAAAAGGTGGAGCAAGAGCTCTTCTGGAAGGTTGGTGCACATAATTACCATTTTAACCACAACATATGTTTGTCTAGCACAGACGGTCATTTGTTTGTTTTTTTGTTTGCCAGGCTGAGCGCTCAGATCTATCTTCTAAACCAAATCTATACAAAGTCCTTTATTCATTTGAAGCTTATAGGAACAATTGGAGGAAGGCAGCTGGATGCATGTACAGGTATTTTGTTAGATTGAGTAGAGAGGGGGAAGCAGGTGGAGGCCGCCAACTCACTCATGTATTACAAGAGAAGTTGCATGCTTTGTCTACTGCTATCAACTCGTTGCAGCTTGTTGAACCCTCATGTGCCTGGCTCGATTCGGTTTGTGAAGCTGATGATCAAATTTCGCCAAGCAAAAAGCCTCGTAATCTTTTGATGGAGAACTGTATGTTGACTTAAGCTCTCAATTCCTGTTAGTTTATACCTGTCAACAACAATGTGCTTGATTAAACTTTGTTTCCTGTATACAGCTGCTTTTGGCACAGATTCAGAACTCTCTACATTGCAGTTTTGTGTTGACATTGAAATTCTTGAAAAGGAATACACACTAACAGAAGCACTTTATATGCTTAGTACTGTAAATTCTAAATCCAAAATTTCTGGTACGTGCCCAACTATCACACACACATTTATCAATTTTGAAGATCAATATTTAAACAAGCTGTGGCCAATTCATTTTTGTGGTACTGCAGAAAGCTATTCTATTGAAGCCTTGACTGACATTCTTGTAAATGAGAATTTGTATGACCTGGCATTCACCATCGTACTGAAATTTTGGAAGGAGTCAGGAATGAAAA
Type
EST
SNP
PCR primers
BJ277289A_F1 GAGTACACCGAACTGTGCC
BJ277289A_R1 ACAGTCAGATTAGTTCACAGTCA
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01