Query (optional)   in Class  

GrainGenes Probe Report: BM134437-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM134437-3A
Data at Wheat_SNP
BM134437-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;DEL at 22;74
SNP G>A at 233
Reference sequence GGATCAATCCTGTTTTAGCCAAGGTAAGAGAGAGGTTTGTGTTTGTGAGTATTCAACATAGAAGTAACTCGGGGTTTTCAGTGGCTCTAATTCTCTGCGACCAGAATATCACTGTGACGGCAAGCAGCCCAAATTCGAGGTACACGGATCCAAAGGCTCTGGTTTCAAAAAATTACCAGGTATCGATGTTGTTGAGAATGCTTGGAATATTATTTTTTTAGTATTATTTTCCCTTGCATGGGATAAAGTTGACATGTTGGGACACATGACATCAGGGGACTTGTTTTGCTGGGCCTCGAGACGAAGATGGCAAGAAGTGTTCTTGGTGGATGGTACACATTG
Reference sequence TTTGATGGTGATTAACAATGGTGTGATCTACTATGCTGGGACGTCATTCGGGAAGCATCAATGGATCAATCCTGTTTTAGCCAAGGTAAGAGAGAGGTTTGTGTTTGTGAGTATTCAACATAGAAGTAACTCGGGTTTTCAGTGGCTCTAATTCTCTGCGACCAGAATATCACTGTGACGGCAAGCAGCCCAAATTCGAGGTACACGGATCCAAAGGCTCTGGTTTCAAAAAGTTACCAGGTATCGGTGTTGTTGAGAATGCTTAA
Type
EST
SNP
PCR primers
BM134437A_R3 AAGCATTCTCAACAACACCG
BM134437_cpF1 TGATGGTGATAACAATGGTGTG
Sequence
WHE0490_C10_F20ZS
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01