Query (optional)   in Class  

GrainGenes Probe Report: BM134437-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM134437-3B
Data at Wheat_SNP
BM134437-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 210
SNP A>G;INS at 4;4,1
Reference sequence GCAAAACAAGTCCCCTGATGTCATGTGTCCCAACATGTCAAACTTTATCCCATGCAAGGGAAAATTATTACTAAAAAAATGTTTTCAAAGCATTCTCAACATCAATACCTGGTAATTTTTTGAAACCAGAGCCTTTGGATCCGTGTACCTCGAATTTGGGCTGCTTGCCGTCACAGTGATATTCTGGTCGCAGAGAATTAGCGCCACTGAAAACCCGAGTTACTTCTATGTTGAATACTCACAAACACAAGCCTCTCTCTTACCTTGGCTAAAACAGGATTGATCCATTGATGCTTCCCGAATGACGTCCCAGCATAGTAGATCACACCATTGTTATCACCATC
Reference sequence TTTGATGGTGAATAACAATGGTGTGATCTACTATGCTGGGACGTCATTCGGGAAGCATCAATGGATCAATCCTGTTTTAGCCAAGGTAAGAGAGAGGTTTGTGTTTGTGAGTATTCAACATAGAAGTAACTCGGGTTTTCAGTGGCTCTAATTCTCTGCGACCAGAATATCACTGTGACGGCAAGCAGCCCAAATTCGAGGTACACGGACCCAAAGGCTCTGGTTTCAAAAAATTACCAGGTATTGATGTTATTGAGAATGCTTGGGAAACATTTCTTTTAGTATAATTTTCCCTTGCATGGGATAAAGTTGACATGTTGGGACACATGACACCAGGGGACTTGTTTTGCAAAAGAGCCTTTGGGT
Type
EST
SNP
PCR primers
BM134437B_R2 GCAAAACAAGTCCCCTGG
BM134437_cpF1 TGATGGTGATAACAATGGTGTG
Sequence
WHE0490_C10_F20ZS
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01