Query (optional)   in Class  

GrainGenes Probe Report: BM134437-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM134437-3D
Data at Wheat_SNP
BM134437-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;A>C;C>G;A>G;G>A;A>C;T>A;A>G;G>A at 108-109;134;165;168;235;250;261;308;342
Reference sequence TAACAATGGTGTGATCTACTATGCTGGGACGTCATTCGGGAAGCATCAATGGATCAATCCTGTTTTAGCCAAGGTAAGAGAGAGGTTTGTGTTTGTGAGTATTCAACATAGAAGTAACTCGGGTTTTCAGTGGATCTAATTCTCTGCGACCAGAATATCACTGTCACAGCAAGCAGCCCAAATTCGAGGTACACGGATCCAAAGGCTCTGGTTTCAAAAAATTACCAGGTATTGGTGTTGTTGAGAATGATTGGAAAACATTTTTTTTAGTATAATTTTCCCTTGCATGGGATAAAGTTGACATGTTAGGACACATGACATCAGGGGACTTGTTTTGCTGGGCCTCGAGACGAAGATGGCAAGAAGTGTTCTTGGTGGATGGTACACATTGGACAGGACCAC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01