Query (optional)   in Class  

GrainGenes Probe Report: BM134557-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM134557-3A
Data at Wheat_SNP
BM134557-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;G>A;A>T at 9,1;239;442
Reference sequence TTTCAGTCATTAGTGCATTCTCAGCTGTCATTGATCGTTTAGGTAACACCTCCCTCCCCCCCTCCCTCTCTGCTACAGTACTTGCTAAGGTGCCTAGGTTAACCTAATTGAACTTTAAACCACAGGTGAATTTGATGATCTATTGGGTGAAAATGAGTCTTCTCTATCACCCCAACGTGATAGCATTGATGGGATCAACATCTCTTTCAAGAGCGGCAGTCCTTCTGTTCTTAGTTCTGATGGATCACAAATGCAATCTGAGCCAGGCATAGTTCTAGAGATTTGTGATTTGACATTGTTAACACCTAGGGGTGGAAATATTCTTATCACTGACTTCAGTATGGAATTAAAAGACAAGGACCACCTACTGGTATTTCATGTCTTATATCTGGTTGTACAATCAGTAACATAAATAATACTGGTGACATCAGACTGATGTGGAGTTCTCATTATTACTTTTAGGTGATGGGACCCAGCGGCTGCGGGAAGACCTCATTGCTCCGTGCTTTGGCTGGCCTTTGGACTAGTGGCACT
Type
EST
SNP
Sequence
NSFT03P2_Contig991
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01