Query (optional)   in Class  

GrainGenes Probe Report: BM134557-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM134557-3B
Data at Wheat_SNP
BM134557-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS at 122,4
[ Show all 15 ]
Type
EST
SNP
PCR primers
BM134557B_R1 GCAAAAGCACGCAGCAAC
BM134557_cpF1 ACCAATCGGTGTCTGCTTTC
Sequence
NSFT03P2_Contig991
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01