Query (optional)   in Class  

GrainGenes Probe Report: BM137722-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM137722-2A
Data at Wheat_SNP
BM137722-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;INS;G>C;T>C;C>G;A>G;A>C;T>C;A>G;G>A;A>G;C>T;G>A;G>A;A>G;G>A;T>C;A>T;C>G;C>T;C>T at 132;225,12;233;241;249;263;267;270;274;276;284;288;324;328;88;97;102;109;135;297;321
[ Show all 12 ]
Type
EST
SNP
PCR primers
BM137722A_R1 CCTGCTTGGACATGGTGGTT
BM137722_cpF1 CCGAGACTTCTCATCCTTCG
Sequence
NSFT03P2_Contig13915
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01