Query (optional)   in Class  

GrainGenes Probe Report: BM137722-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM137722-2B
Data at Wheat_SNP
BM137722-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;G>A;C>T;G>T;C>T;A>T at 62;85;109;154;223;291
[ Show all 10 ]
Type
EST
SNP
PCR primers
BM137722B_F1 AATTTCCTGCTGCACGAGGTT
BM137722_cpR1 CACAGGAAGTCGTAGCCACA
Sequence
NSFT03P2_Contig13915
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01