Query (optional)   in Class  

GrainGenes Probe Report: BM137879-1A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM137879-1A
Data at Wheat_SNP
BM137879-1A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;A>T at 575;594
SNP DEL;G>A at 404-405;575
Reference sequence TGTAAGTCGAGATTTTCACCCACCTTTTCATGGTTCATTGCAGAAACCAGACCTGGTGATATTTGTGATGGATGGCAGTATTGGTCAGGCTGCGTTTGATCAGGCACAAGCATTTAAACAAAGTGCTTCTGTTGGTGCTGTCATCGTAACGAAATTGGATGGTCATGCAAAAGGAGGCGGTGCACTTAGCGCGTTAGTATTACTTTTTATTTTTCTTGTTCTTCCTGGTGCTATTTCCTGTATCGTGTTGCTTATGAGCGATATTATTTACAAAGAATCTAAGTTAGCTTAGTTTGTTCTTTGGTAAAATTTCTTCATTATAATTCTTCTTGTGGGATTTTCCCCCTCTGGTTAATATGTCCTTCTAGAGTTGAATTTCATTTTACCAGGTTACATATCATCCATGTTATTTTAGTTCAACAAGAAAATGCTACTTGGTTTAGGATCACTTCAATCTGAATGGTTGCACATATGTTTAGTGTATCTGTGAAGCAGTTAAGATTGTTATTTATCTGCTCAGCTGTATTCTCAAATCCTGTTTTAGCTTCTTTTTTTATTGTGTTTATTACAAGTAGGCGAGGATACCGTTTGTTAGAGTAAACAGGTGAAGAATCAGAGGAACTTTTTTTTTACATCCTTGCCTCTTTTTTCCCCAGGGTTGCAGCTACAAAAAGTCCAGTGATATTTATTGGAACTGGAGAACACATTGATGAATTTGAGATTTTTGATGTGAAACCATTTGTCAGCCGTCTGCTAGGTTAGCAACTACATTTAATATTGTGTGTAGCTGGGTGTTTCTNCTTTCTAGTTTACCTAATGATGTATTTGTCAGG
Type
EST
SNP
PCR primers
BM137879A_R1 AGATAAACAAGACGACGGAG
BM137879_cpF1 GAAATGCGTCAAGTTGCAGA
Sequence
NSFT03P2_Contig16882
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01