Query (optional)   in Class  

GrainGenes Probe Report: BM137879-1B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM137879-1B
Data at Wheat_SNP
BM137879-1B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 556
Reference sequence TGAAACAGACCTGGTGAATTTGTGATGGATGGCAGTATTGGTCAGGCTGCGTTTGATCAGGCACAAGCATTTAAACAAAGTGCTTCTGTTGGTGCTGTCATCGTTACGAAATTGGATGGTCATGCAAAAGGAGGCGGTGCACTTAGCGCGTTAGTATTACTCTTTATTTTTATTTTGTTCTTCCTGGTGCTATTTCCTGTATTGTGTTGCTTATGAGCGATATTGTTTCCAAAGAATCTTAGTTAGCTTAGTTCTTTGGTAAATTTTCTTCATTATAATTCTTCTTATGGGATTTCCCCCGTCTGGTTAATATGTCCTTTTAGAGTTGAATTTCATTTTACCAGGTTACATATCATCCATGTTATTTTAGTTCAACAAGAAAATGCCACTGGGTTTAGGATCACTTCAATCTGAATGTTTGCACATATGTTTAATATCTGTGAAGCAGTTAAGACTTAAGATTGCTATTTATCTGCTCAGCTGTATTCTCAAATCCTGTTTTAGCTTCTTTTTTTATTGTGTTTTTCACAAGNAGGTGAGGATACCGTTTGTTACAGTAAACAGGTGAAGAATCAAAGGAACCTTTTTTTTACATCCTCGCCTCTTTTTTCCCCAGGGTTGCAGCTACAAAAAGTCCAGTGATATTTATTGGAACTGGAGAACACATTGATGAATTTGAGATTTTTGATGTGAAACCATTTGTCAGCCGNCTGTTAGGTTAGCAACTACATTTAATATTGTGTGTAGCTTGGTNGATTCTTCTTTCTAGTAGTTTACCTAACGATGTATTTGTCAGGTATG
Type
EST
SNP
PCR primers
BM137879B_F1 TAATGTTGAGATTTTCACCGAA
BM137879_cpR1 TCATGTCCTTTTGGCATCAA
Sequence
NSFT03P2_Contig16882
Linkage Group
1B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01