Query (optional)   in Class  

GrainGenes Probe Report: BM140538-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM140538-2A
Data at Wheat_SNP
BM140538-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP at
SNP T>A at 219
SNP DEL;DEL;A>C at 17;27;46
Reference sequence TCTTGTAAATTATGCTTTCCAACTCCCAGGAAGCCTTTATCGCTGTGTTATGCTTAGTCCTTGCTCATATTTTAGGTATGGATCGACGAATCTGATGGCAACACAACGGAACAGATATGTGATGCCAGCGGCGAAGACCCAAACTGCTGCAGGTTTTTACAGAGCACAGACCTTCCTTGCAGCTCAACTGCCTGTCTCTTTAGCTCCTAGTTCTAACATTATCCCCATCTATCGTCTTACTAGGTGCCTCTCCATATTGAGCCTGAGCATTCAGGACCATTTCACATACCTGGGAGTAGACATGGAATCAGATGACTGGAGCACCTGC
Reference sequence TGAATGGTCCTGAATGCTCAGGCTCAATATGGAGAGGCACCTAGTAAAACGATCGATGGGGATAATGTTAGAACTAGGAGCTAAAGAGACAGGCAGTTGAGCTGCAAGGAAGGTCTGTGGTCTGTAAAAACCTGCAGCAGTTTGGGTCTTCGCCGCTGGCATCACATATCTGTTCTGTTGTGTTGCCATCAGATTCGTCGATCCATACCTAAAATATGAGCAAGCACTAAGCATAACACTGTGATAAAGGCTTCCTAGAAGTTGGAAAGCATATTTATAAGTTTGTGCCCAAGGTATACCTCTCTTGGGAAGTGGTGG
Type
EST
SNP
PCR primers
BM140538A_F1 CTTGTAAATATGCTTTCCAACTCCC
BM140538_cpR1 TGATGATTCTGCAGGTGCTC
Sequence
NSFT03P2_Contig15135
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01