Query (optional)   in Class  

GrainGenes Probe Report: BM140538-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BM140538-2B
Data at Wheat_SNP
BM140538-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;G>A;C>T at 39;232;239
[ Show all 10 ]
Type
EST
SNP
PCR primers
BM140538B_R1 AAAACGATCGATGGGGATAATGTC
BM140538_cpF1 TCCAAACTGACGTACCACCA
Sequence
NSFT03P2_Contig15135
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01