Query (optional)   in Class  

GrainGenes Probe Report: BQ160340-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ160340-3A
Data at Wheat_SNP
BQ160340-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;T>A;T>C;G>T;G>A;G>A;C>A;C>A;C>A;G>A;A>C;C>A;C>T;G>A;A>T;T>G;A>C;T>G;C>T;G>A;DEL;A>T;G>A;INS at 21;23;25;27;28;30;63;64;107;111;155;173;177;179;194;229;232;240;265;266;700;804;1035;1056,1
Reference sequence TAAAACATGTGGGTACAAGACATTTCGGAGTTGCAGCAGGTTCATCAACCAATGTAGGCAATCCGGTTTGCAACTCATCATCGGTAAGTCTTTAGCTAGAGGCAGCCGGCGAAAAACAGGAGAGCCAAAAGAGCCATGATAATATAATAATGCAAAAGCCTCAGATGCAGCACTTACCGTCACATACTATTTGACAAACAATGTAGGCAAGAACTTCACTCATCATCATCAATACCCCATAAGTGCAAACTGACATCTGAACTCCGGACCAAACAAAATATACACTGGTTCTCACAAGATTGGTCAAACGATATAGGGAATAAGGTGTGCAGCTCATCATAGGTAGAAAAGCCACAAGCCAAGTAACTGAATGTAAATAATAAAAATATATAGAAAAAAACATTGAATTTTTAGTGCATTTTTTCATCCTCAGTCCTTGAGGAAGCTTCTCATAAGATTGATCAAACAATGTAGGCAATAAGGTTTGCGACTCATCATAGGTGGAAAGCCCACAAGACAAGTAACCGAATGTAAATAACAAAAATATAGAGAAAAAATAATCAAAGGATTTTTAGTGCATTTTTTCATCCTCAGACGTTACAGAAGCTTCTCATAAGATTGATCAAACAATGTAGGCAATAAAGTTTGCAACTCATCATAGGTAGGCAGCCAAGGACGACTACTTTAAGCAATAAAAAAACGCAAATAACACCATGTTTAGCTAAAAAGAATAAACACAAACAGAAGAACTATCGTACTGAAAAACCTCAGATGTTGCAATTATTATCACAAAATATTTCTCAAACAATGCAAGGCTAAATGTCTCTGCAACTAATCATCAGCAAAAATCAAGAGGTGCAAAAACTGTAAACAGATTTTTGATTATACAGCATAAAAGACTAGATTGAAGCTGGGTCTAATAAAAGGCACCGTTCCATCCTCAGAGGTTGCAGAAGTTCTCATAAGATTGATCAAACAATGTAGGCAATACTGTTTGCAACTCATCATAGGCAGAAACAAGAAATCCAGGAACCGCTAGTAACTAATAATGTAAATCGAATCC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01