Query (optional)   in Class  

GrainGenes Probe Report: BQ160340-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ160340-3B
Data at Wheat_SNP
BQ160340-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;A>T;A>C;C>A;G>A;G>C;G>T;C>A;C>T;A>G;G>T;A>G;C>G;A>G;INS;C>A;G>T;T>C;A>G;A>C;G>C;T>A;T>A;A>C;G>A;T>A;T>A;C>T;C>T;C>A;C>A;G>A;T>A;G>C;G>A;T>A;G>A;C>A;C>T;A>T;C>G;C>T;T>A;T>C;T>A;T>A;DEL at 12;74;87;125;143;149;160;177;210;213;231;236;246;280;306,1;324;350;360;365;366;379;405;423;431;444;445;449;503;505;547;571;574;575;578;584;585;611;615;631;706;727;740;782;815;862;900;1083
Reference sequence TCAGGTAAGGTACATAAATCATTCGGTTAGCGTATGGTTAAAACATGTGGGTACAAGAAAAATCCTAAATTGCACCACGTTCATCAACCAATGTAGGCAATAAGGTTTGAAACTCATCATTGGTCAGTCTTTAGCTAGAGGCGGAGCAGGCGAAAAACAGAAGAGCCAAACGAGCCCTGATAATATAATAATGCACAAGCCTCAGATGCCGCAATTATTATCACATATATGTGTCAAACAATGTACGCGACAAGCTTCACTCATCATCAGAACTACCCCAGAAGTGCAAACTGACATCTGAACTCTGACCAAACAAAATATACCTTGGGATCATTCCATCCTCAGACGTGGAATAAATTTTCACAAGATTGGTCAAACGATATAGGGAATAAGGTGTGCAGCTCTTCATAGGTAGAAAAGCCTCAGGCCAAGTAACTGAATGTGTATATATATAAAATATAGAGAAAAATATTGAATTTTTAGTGCATTTTTTCATCCTCAGCCCTTGCAGAAGCTTCTCATAAGATTGATCACACAATGTAGGCACTAAGGTTTGAAGCCCACAAGCCACGTGTCCGAATGTGTATATCACACATATATACGAAAAAGAGTCACTGGATTTTTAGTGCACTTTTTCATCTTCAGATGTTGCAGAAGCTTCTCATAAGATTGATCTAACAATGTAGGCAATAAAGTATGCAACTCATCATAGGTAGGCACTAGGCACCCAAGGACACCACGTTTAGCTAATAAAAAATGCAAATAACACCACGTTTAGCTATAAAGAATATACACACACAGAAGAGCTATCGTATTGAAAACTCTCAGATGTTGCAATTATTATCTCAAAAAATATTTGTCTAACACTGCAAGGGTAAATGACTCTGCACCTAATCTTCTGCAAAAATCTAGAGGTGCAAAAACTGTATACAGATTTTCGATTATAGAGAATAAAAGACTATATTGAAGCTGGGTCAAATAAAAGGCAGCGTTCCATCCTCAGAGGATGCAGAAGCTCTCATAAGATTGATCAAACAATGTAGGTAGAAACAAGAAATCCAGGAACCACTAGTGACTAATAATGTAAACGCGAATAGAACGATAAGTGAGGGG
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01