Query (optional)   in Class  

GrainGenes Probe Report: BQ160417-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ160417-7A
Data at Wheat_SNP
BQ160417-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;G>T;C>A;C>A;G>T;T>G;INS;G>C;A>C;G>C;INS;T>C at 22;33;53;93;110;112;120,1;139;142;144;165,1;252
Reference sequence GTACAAGGCCACCATGGAGCTCGGCATCCTAGGCCGGTCCACGGGGAAGGCCCAGAGGGTCGTCCCGGCCCCGCCCCCGCTGCCGGCGTCGTCGTCGTTGAGGCGGGAAGCTAGCAGCGCGAACGCCGCCGCGGCGGAGCCAAGAGAGGATCAGGTTCAGCCAACTGCCCGGAATTACCAAGTCTTGTTTGTCTTGTGATGATCATGCATGGAGGATCGATCATTCGCGCCACCTTCTTGAACAAACTGACTGATAAATCAATGTCCATGCAGGTGTGCCCAATCTGCTTGACCAATGCCAAG
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01