Query (optional)   in Class  

GrainGenes Probe Report: BQ160970-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ160970-3B
Data at Wheat_SNP
BQ160970-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C at 218
Reference sequence TCATCGTGGAGCAGGTGCACTTCTATACTTATCCGCAATTGTTCCAATGAATTAGTCTACCTAACTCCCCCAAGTATTGAGGTTCGTCTACTTAACCCTTCAACTATAAAGCCTGGTATTCGACCTCTTAAAAGTATTCAACATTGTCTAAATCGCCCCTAGGTGCAGTTTTGTAGGTGTTTTTTGCACATGCGCCATGTGGACCGCATGGGCAAAGGCACCTCCTAAACGACCCCAGTGAATGATTTAGACAGTATGGAATACTTTTGGGGGTCAGATACCCGATTTTATAGACGAACCTGATATTCGACCTCTTAAAAGTATTCAACACCGTCTAAATCGCACGTAGGTGCAGTTTTGTAGGTGGTTTTTGCACATGTTCCATGTGGACCGCATGGGCAAAGCCACCTCCTAAACCACCCCAGCGAATGATTTAGACAGTATGAAATGCTTTAGGGGCTAGGGGTCAGGTACCCGTTTTATAGACTAGCCTCGATGCCCTGAGGGAGTTAAATAGACTTGTTCCTTACTTAAAATTACTTGTTTTTTTAATTTCACACCATCACATGCATAGAACGGATGAGATTACGTATCTCGATCACGGGGTACAGCCACTTCACCTCTTTTACATCAACAAAGATGCTTCCATGTGATTAATCTGTTCAAAAGCATCAGAATAAAGAGCTTGTTCATCAACTGTGAAATATCTATGTAAA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01