Query (optional)   in Class  

GrainGenes Probe Report: BQ161069-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ161069-7D
Data at Wheat_SNP
BQ161069-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;G>C;G>C;C>G;C>G;C>G;C>A at 26;29;57;118;144;150;404
SNP T>C at 27
Reference sequence CAATTCGCCCATGGCATGTATGGGTGGCGGAAGAACTTCGACATGAGCCCCTTGTCGGGCTTGATAGACTTGAGCCTATGTCGCCCCATGTAGCGGCGGAAGCCGATGATCAGCTTCCCAAAATTGCCGCCATGGGTCATGACCAATACCTCCGACTTCAGGCATACCAGGAAGTCCAATGCAGCAAGGCTGGTTACATGCTTCTTGAAATGCTCTATCTCCTCCTTGCTTGCGAGATCTTCTTTGGTAACCTGCAAGCAACAAAGATAATGGTTCAGTTGTCTCTACAACAAAACCACCTGCTGATGGTTGCTTGCCCATCCATAGGTAATTGTCTCAGTTTCATTTCTGAAACTGTAGTTTCGCGTTATGTCCATATAAAGGCACTTTGAAGTTTGAAGGCCACAAACAGGATTTGCAGTAGAACACCTACCAAATTGGGGAACATATTCCTCAGCGGTG
Reference sequence AAAATTCGCCCATGGCATGTATGGGTTGCCGAAGAACTTCGACATGAGCCCCTTGTCCGGCTTGATAGACTTGAGCCTATGTCGCCCCATGTAGCGGCGGAAGCCGATGATCAGCTTCGCAAAATTGCCGCCATGGGTCATGACGAATACGTCCGACTTCAGGCATACCAGGAAGTCCAATGCAGCAAGGCTGGTTACATGCTTCTTGAAATGCTCTATCTCCTCCTTGCTTGCGAGATCTTCTTTGGTAACCTGCAAGCAACAAAGATAATGGTTCAGTTGTCTCTACAACAAAACCACCTGCTGATGGTTGCTTGCCCATCCATAGGTAATTGTCTCAGTTTCATTTCTGAA
Type
EST
SNP
PCR primers
BQ161069_cpF1 ACATCCTCCACAAAATTCGC
BQ161069D_R1 GCGAAACTACAGTTTCAGAAAT
Sequence
NSFT03P2_Contig2570
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01