Query (optional)   in Class  

GrainGenes Probe Report: BQ161274-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ161274-6B
Data at Wheat_SNP
BQ161274-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 546
Reference sequence CGATACAACTTGAGGCAGAGAATAGCAATATCTAATTGTCCACGTTATTAAAAAAAAAGATGTCAGAAAGGGCAAGCCGCTGATGCTCAAACCACCAAGAAGCAGAAACGTATTTAATCCAATCCAGTAACTACTCTAAGTTTCAACCAAGTTATCCCAACCCAACTAATTTGGGGCAGTTAATTATAGAAACAAAGGAAATCCAGGAATTGGGTAGTTTGAAAAATATGAAAAGAGACTAAACCTCATTTAATAGCTAATACCAACAAGCTGAACTGAGTAAATAGTACTCCCTCCGTCCGAAAATACTTGTCGGAGGAATGGATGTATCTAAATGCAATTTAGTTTTAGATACATCCATTTTCATTCATTTCTCCGACAACTATTTCCGGACGGAGGGAGTATTCAATTTTAACTGATAAGAGTTGGTTACAACTAACAACATGCTAGAAGTTTCCAATTTTACTGTGAGACATCACTGTATTGATCAACAATACAAGAAAAGAGAACTATTTGAATGGAGCAAAGGAAATATCATAAATGTTCGTTTTCAGGTAATAATTCACTGGGAACAGTGGACTTCTTAAAGTTCAAACACAGCATGCACAACAAACATATGATTCAATTTATCTAACACCCATTTGAAACCTCTCAAAAGATCCAAACAACTGAAAATCACACTGATTTAACAAACATATTAGTATCACCCTTATCAGAAGTTTAGGAAT
Type
EST
SNP
PCR primers
BQ161274B_F1_UCW TACTACATGGTAGGGCGATAC
BQ161274B_R1_UCW ACAGTAGTCCTGAGAACATTC
Linkage Group
6B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01