Query (optional)   in Class  

GrainGenes Probe Report: BQ161574-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ161574-5A
Data at Wheat_SNP
BQ161574-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>G;T>C at 282;307;320
Reference sequence AAGGTGGTAGTTCGGCGCGACCCTGGCGATGTCGACATTATTTGGAGTCACCTGTTCCAAATAGCAATTTAACTCGAGACACTTGGTGGGGGTTCTTAGTGACTGCAATCACAAACATGAGACTGGACTGAGACGCCTTTACCTTTTCTTCCATAACCTGTTTCAGGATAGATAGAGCAATGGTTTCAGCCTCCTGAAGGGTCAGCTCCTGCAGAAGAAACTCAATCATCAGCTTTCAGAAACATGGTGCAAGTATCGACATACAGCAGAGAGTGGTGTGGCCACGTCATGGTTTTCTTCACACAATATTAGAAACACATCACTTTCAGCATTATGGTCTCCTAGCTATGATCAATCAACGTTAGCAT
Type
EST
SNP
PCR primers
BQ161574A_R1 GGAAGCTGTAATGCTAACGTT
BQ161574_cpF1 GCAGGGGTGTAAAGGTGGTA
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01