Query (optional)   in Class  

GrainGenes Probe Report: BQ166999-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ166999-5B
Data at Wheat_SNP
BQ166999-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 110
SNP T>G at 381
Reference sequence CGAGGGGCAGAAAAAAGATAAGCAGACTAGAAATATCCACTACAAGCAAGACACAAACTAGGTGATGGATAGTGATACCTTCCAAGCTGTCAATTGGATGTTTGCAAAGTCCTTCTTGACCTTGCTCTTTACTTGCCCGAATGGCCTCCCTGAAATTTTTTAAAATTACTTTCCATGTTGCCGTTACTCGCTGAAAAAAGGAAGTTCAACAGAGAATGGATGAATACACTTGCAGTCCGATTAATGCACAAGACTTGGCCAGGGAAGTGCCTACAATCCTAAATAGCAATAAATGCATTTTTTCCTCGGCAAAATTCAAAACGGTAACCTACAGCCCCAGGAACTCACAACTGAACTGGCACTAGCATTTTTATTTTTATTTTGGAAAAGAAGGGACAGACCAAGTTGTAGTCATTTTGTAGAAATGAAATGACATCTGTACATATACATGAAAAGAGCTGCCAGCAAGATTTCTCTTGATATCTGTACATATAGAGGAGTTTGATGGAAAATAAAATATGCATTCAACTTAGAATACCTTCAACTACCAGACCGTAGTACATCATGAACATCATATTGTTCCATGGTGATACAGT
Type
EST
SNP
PCR primers
BQ166999B_F1 TCTAAAGCATTTCGAGGGGCA
BQ166999_cpR1 GGAGCAGCTAACTGTATCACCA
Sequence
NO
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01