Query (optional)   in Class  

GrainGenes Probe Report: BQ167580-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ167580-3A
Data at Wheat_SNP
BQ167580-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;C>G;G>T;G>A at 9;10;11;549
[ Show all 6 ]
Type
EST
SNP
PCR primers
BQ167580A_F2 ACAGTTGGTAGTTCTGACTCCTGG
BQ167580_cpR1 TTTGCTCTTGGGAACTCAGC
Sequence
WHE0077_G05_N09ZK
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01